FAQs

ALSTEM’s cryopreserved cell products are delivered to your destination in dry ice, and Cryoport liquid nitrogen shipping solution is also available upon your request which is more expensive.

We do not authenticate the cells in house; however, we can send the cells to ATCC for authentication if requested.

Yes, all cell lines we generated were tested by our MycoDect™ mycoplasma detection kit (Catalog No. MD050). We promise that all of ALSTEM's cell lines are mycoplasma-free.

If the cells were stored in the gas phase in nitrogen containers, they can be frozen for several years at a time without any problems.

Yes, we licensed the technology from iPS Academia Japan, Inc. This licensing agreement enables us to develop, manufacture, and distribute cell products using iPSC technology.

Yes, karyotyping has been performed on most of our iPS cell lines. Currently, we do not provide karyotyping services. Our reliable partners conducted chromosome related assays.

We won't guarantee passages you have; however, we have passaged our lines for additional 15 passages without losing pluripotency.

They are differentiated from neonatal foreskin fibroblast derived human iPSC line. It is from fetal sources.

The cell lines are derived from human fibroblasts.

Yes. We used our episomal iPSC reprogramming kit (Catalog no. RF202).

IPSCs could be generated by our episomal or retroviral reprogramming methods, depending on the customer’s request. Please check our website or contact us for more details. ESC-like colonies will be picked by morphology and will be confirmed by immunostaining of multiple pluripotency markers (e.g., OCT4). So far, iPSC was successfully generated from PBMC, fibroblast, dental pulp stem cell, etc., with species of human and mouse.

This mouse iPS cell line is derived from male C57BL/6 mouse embryonic fibroblasts (MEFs).

To generate iPSCs, we transfected these cells with the episomal vectors containing Yamanaka reprogramming factors (OCT4, SOX2, LIN28, KLF4, and L-MYC) using electroporation. We followed the protocol from Yamanaka’s paper as follows.

Okita K, Matsumara Y, Sato Y, et al. A more efficient method to generate integration free human iPS cells. Nature Methods 8, 409-412, 2011.

APOE PCR primer set

APOE Primer-F:
GAACTGAGGTGAGTGTCCCCAT

APOE Primer-R:
GCTCGAACCAGCTCTTGAGG

~1205bp
Tm = 65.5°C; 1min,30 sec extension
Thermopol Buffer, (+)DMSO, Taq enzyme

APOE sequence primer
GGCCTACAAATCGGAACTGGA

We used PCR primer to amplify the target region and sequence primer to sequence the amplicon.

Our iPS11, iPS15, iPS16 and iPS18 lines are derived from different donors. The characterization information for these cell lines is listed in the table below:

+: data available

-: data not available

*: We differentiated the cells to neurons and cardiomyocytes successfully

250-500 ng/ml

Yes, it is same.

Yes, it is HIV-based, self-inactivated, replication incompetent third generation lentivirus. Any lentiviral titration kit could be used for detection of the virus presentation. Contact us for more details.

Yes, SV40 T antigen does, as well as the puromycin resistance gene.

Based on our experience, it would be hard to confirm that.

We recommend that the final concentration of puromycin will be 0.5-1 ug/ml.

Yes. We do offer discounts for non-profit organizations.

The optimal concentration of puromycin varies among different types of cells, eg. 0.5-1 ug/ml for fibroblasts, 1-2 ug/ml for HEK293 cells, 10 ug /ml for CHO. If you are not sure about the concentration, you may test the kill curve for the cells using different puromycin concentration from 0.1 – 10 ug/ml.

hTERT is driven by CMV promoter and puro/neo by EF1a.

We usually use MOI of 5, which in turn 1-3 copies will be inserted into most of the cells.

The retrovirus we produced is VSV-G pseudotyped and the retroviral gag/pol is in a separate plasmid and driven by CMV promoter. Upon your request, we can also provide ectropic pseudotyped retrovirus.

For hTERT Cell Immortalization Kit, Cat# CILV02, it is on a third-generation expression vector and we packaged with a third generation mix

We usually generate an immortalized cell line by overexpressed gene SV40 T antigen or hTERT. For more details, please contact us. ALSTEM scientists are happy to provide a free consultation.

Briefly, the 2nd generation uses two plasmids system, while the 3rd generation uses three plasmids system, which is safer. Please check our website for more information.

Qe resuspend in DMEM so that they will be capable for in vivo applications. We can also use other resuspension options upon request.

Yes, we can provide 20 x 5 µl aliquots of viral particles for 100 µl volumes. Please put a note in the PO (note: we will charge additional for such aliquoting).

We use episomal vectors to reprogram PBMCs and don’t have direct experience using the retroviral method with PBMCs. In case helpful I’ve attached a good reference for the episomal method on PBMCs.

In theory, using the retroviral vectors should be easier as the delivery of transgenes is more consistent than with electroporation. We recommend referring to the literature for additional perspectives such as the paper below:

Febbraro F, Chen M, Denham M. Generation of Human iPSCs by Episomal Reprogramming of Skin Fibroblasts and Peripheral Blood Mononuclear Cells. Methods Mol Biol. 2021;2239:135-151. doi: 10.1007/978-1-0716-1084-8_9. PMID: 33226617.

It works well in HEK293 cells and would be efficient for other cell lines. Transfection conditions should be optimized for each cell type.

NanoFect does not work for suspension and most of the primary cells. The best choice for primary cells is electroporation.

NanoFect only works for some common cell lines, such as HEK293 cells. If you are not sure what cell lines you are going to transfect, NanoFect may work efficiently.

NanoFect only works for some common cell lines, such as HEK293 cells.

This kit enables the detection of a broad range of mollicutes, including Acholeplasma laidlawii, Mycoplasma arginini, M. fermentans, M. hyorhinis, M. orale, M. pneumoniae, Mycoplasma gallisepticum, Mycoplasma synoviae, and Spiroplasma citri—species that highly occurred during cell culture.

While some kits may detect a larger number of strains, they often sacrifice sensitivity. Our kit focuses on the most prevalent species and provides reliable, cost-effective detection, making it an excellent option for routine use.

Yes, you should add ViralBoost again to keep the virus packaging process running at highest yield for the second collection.

If you’re not using VSV-G as an envelope protein, it may make sense as VB100 may slowdown the cell proliferation. If VSV-G is used, you should observe more fusion cells rather than cell shrinkage.

It should not be used in virus aliquots intended for in vivo applications. However limited use in nude, NSG, or NOG mice would be ok.

The residual solution would not be safe for in vivo use, so you should switch to ultracentrifugation for these preps.